This Cruel Design was one of my most highly anticipated sequels of 2018, and it didn’t fail to crush my heart.
This review is spoiler-free but exercise caution when reading the book’s synopsis if you haven’t read This Mortal Coil yet.
About This Cruel Design
Publisher: Simon Pulse | Release Date: October 30, 2018 | Pages: 394
Genre: Young Adult, Science Fiction | Format: Hardcover | Source: Purchased
The nightmare of the outbreak is finally over, but Cat’s fight has only just begun.
Exhausted, wounded, and reeling from revelations that have shaken her to her core, Cat is at a breaking point. Camped in the woods with Cole and Leoben, she’s working day and night, desperate to find a way to stop Lachlan’s plan to reprogram humanity. But she’s failing—Cat can’t even control her newly regrown panel, and try as she might to ignore them, she keeps seeing glitching visions from her past everywhere she turns.
When news arrives that the Hydra virus might not be as dead as they’d thought, the group is pushed into an uneasy alliance with Cartaxus to hunt down Lachlan and fix the vaccine. Their search takes them to Entropia, a city of genehackers hidden deep in the desert that could also hold the answers about Cat’s past that she’s been searching for.
But when confronted with lies and betrayals, Cat is forced to question everything she knows and everyone she trusts. And while Lachlan is always two steps ahead, the biggest threat to Cat may be the secrets buried in her own mind.
This post uses affiliate links and I may receive a small commission for purchases made through my links at no additional cost to you. Click here for more info.
Goodreads Amazon B&N Book Depository
My Review of This Cruel Design
“If there is a design that underpins us, Catarina,
then it is cold, it is violent, and it is cruel.”
One of the biggest surprises that I read in 2018 was Emily Suvada’s debut novel this Mortal Coil. I’ve shouted about this book countless times and shoved it in the hands of many of my friends so they too could have their hearts broken experience this amazing book for themselves. My Twitter mentions are full of people screaming at me, and it brings me immense joy like the Slytherin that I am. Suffice to say that I was anxious & terrified to see what is in store next for the characters that I have come to love would be a drastic understatement.
📝 Related: read my spoiler-free review of This Mortal Coil
Just when you thought everything was over, the story seems to have only just begun. The plot thickens for our group: this is a solid continuation of the series and the story is plotted intricately well. Reading the overarching storyline of the series is like a play broken down into three acts, and Suvada plotted it very well.
For those of you that have already read This Mortal Coil, you already know what to expect from Suvada’s writing. The stakes have been raised and I was on the edge of my seat while reading, devouring every word as I tried to piece together what the heck was going on. I didn’t know who to trust and honestly, my heart couldn’t take it.
I will admit that this book took a bit of time for me to settle into. I first tried to read this one shortly after publication as a This Mortal Squad buddy read, but I fell behind on the first day and waited a couple of months for my expectations to calm TF down. (I briefly talked about my fear of next-in-series titles for books that I fell into fangirl love with a couple of months ago in my Sophomore Novel Fear discussion.)
I picked it up again for another group read in January with Sam & Soph because I forced the series on them and now they wanted to read it with me. Huzzah! Same thing kind of happened… we all just kind of didn’t prioritize reading it for about a month. But once we did find the time to all sit and read together through the first few chapters we were hooked. Even though this book has a bit slower of a start, it still brings the chapterly (is that a word? it is now) revelations and WTF bombs and the slower pacing at the beginning is worth it.

My favorite part of this installment in the trilogy is the exploration of the relationship between Leoben and Cat. Suvada is masterful with character development, and she does an excellent job in this book to bring more life and mystery to each of the characters. Everyone’s shrouded in mystery and secrets. Everyone’s past is a bit blurry. And I trust no one. (But I really want a t-shirt with a squid on it.)
At its core, This Cruel Design lies at a crossroads where Cat tries to figure out what makes her her and where the ethical line to genehacking and modifications lie. I love the ethical and moral dilemma of technology and science, so I really appreciated how this kind of takes center stage in the book.
“You are not your face, Catarina. You are not this body, either. I could take either of them from you, theoretically, and you would still exist. You don’t have blood in your hair or broken fingernails. You don’t have any hair at all. The entirety of you weighs a little over four pounds.”
“If you drive a car, you don’t become a car. You’re always just the driver. Don’t buy into the vehicle of your own flesh.”
Cat is very much torn between who she believes herself to be and the person of her past that she cannot remember, and the plot is centered on that uncertainty. On whether or not the ends ever justify the means.
I think there is no better feeling in the world than watching your friends suffer while reading books that left your hear rended.@Sammers65 is reading THIS CRUEL DESIGN and is having a time. My work here is done. pic.twitter.com/GmdtUKtkc7
— Kal @ Reader Voracious (@kalventure) February 12, 2019
Overall, while the pacing of This Cruel Design was a bit slower for me to get into this was an amazing read that lived up to the glory of the first book. The stakes have been raised and our characters are all trying to do what they feel is right; right or wrong are both justified here and makes the reader question their loyalties. I absolutely love this series and will continue to shove it at everyone who will listen to me. THIS WILL BE MY LEGACY!
Initial thoughts: 💥💥💥

🤝 (Failed) Buddy read with Becca and Taylor, and successful buddy read with Sam and Soph a couple months later.
Content warnings: mild gore, medical procedures
Recommended if you enjoyed…
Contagion by Erin Bowman
Pitch Dark by Courtney Alameda
Other Books by Emily Suvada


I’ve been meaning to read This Mortal Coil for some time now and your utter excitement for its sequel may just be my push to get going on it! Great post!
YES you need to read it, the series is so good! it’s a sign that you need to dive into this world.
Ahahah well I’ve placed the book on hold at my library so I’m sure you’re gonna hear my thoughts on it soon!
Excellent!
TGAACTTGAACTTGGCAGGTGCTCATGATTTTAGCCAAGCAGGGAGTTAGCACTTGAGGTCCTAAGGACCATTACAATTTTCGGTAGCACCAGATATGCACCGCAGGACCCCAGCTCAGCAAGTATATACCTATTGACGTATCAACCTCGGCTGCGTCAGACCCTCTTAAGAAAAAACGCAGATAGCACATTACCTGAAGTGGGTACCTACATATAACGATACAACGAGGGGAGGACGCGAGGTCACGATCAGGGTTTCTAATAACATCTTCTTGTTTTATCCATTGCACCTTAAGAGGTGGCAAACATAATACCAGCCTTGCACGCGTAGATATATCCTCGATAGCTGCGCTCGACGGATGCATGGCACCTACTGTCCCTACATACTAAAAACCTACTCACGCTCCTTGGAAGTGACCAGCGAATCTCGAAATCATTAATGTAGTTCATGTTTAATCGTAAGGTCCAATACAGCAGGGTTTCTTTTAAGGACGGAAGCACGGCTTCATTATTCGTGCATTCCAGGCCACCTCGCAACGTAGGCACGTAGACACCGATCAATCATTTAAGGTGCCCTGGAAGTTAGCAACTTAACTGCGATTCATATTTGTACGGCTCCTCCCTAGCTCGAATGCCCTAGTTGTTTTATGCAACTGAGCGGAATTCCTGATGTGGCAACCAGGCAGATAACACCGAAAGTTATATGAAACCGTGCGATCTTGCTACAGTCGTTATCTGCGTGATTAGTTTTTTGAGTAGTAGCTTCTCTGCGAGCTTGCACTAGAGCTTGACTGCGTCGCAAGAAATTACATGACGAGCTAAACACCAGCATAACAGGCATTGATTAAAGTACGCAACGAGCCCTGGCACCCTTGATATATGGCTGGCAGGAAGAGTTCATAAATGCTCGCTACCTTCACTCCTTCAGTCCTAGAAATCAATATTGCCTCATTGCACCCGAAGATTTAACGTAGGCAGGATCTCACGCAGTATTGTATAATCCAGGGGTCGGACACTCGGAACTAACTTAATTGGTAGCGACGCAAGAACGGAGAGAGCATTCTAGGTTAGTAGCGCTACAACAAAAATCCTGAATACGTATAGAGCTCCGAACGTACTTTCCGATCCAAGTTATTTGGACGCGTGCTGGCTATCTATAAACGGAGATAGGAGAAATGCTAGACTTCATAAAACCGAGATAGGTGTAATCCACTAGTGCCTAGTTGGTAGATTTCTTATTACGTCTACTCCAGGGTTGCCATGCAGGGACTTAGCATAAGACCTGCAAAGCTGGTTTCCAGCTGAGGATCACTGGAGCCATCGCTGATAAGAGCGTTTCATAAAACTAAGTGAGAAGCTGACTTCATCACAAGGTAAGTCGATGAACATTAAACAGTCGCTCTATGTGATCATTAAAGTTCCGATCTTACTCTGATTCTGTGATACTTTACTATTTTCTATAACTCTTGGCTAGACATGCTCAGAGCCAGTAACACAGAGATGAAGTGTAGCTAGTAATAAGTTCGCATGTACGCGAGTCTGCCATCATAAATGACTTATAGTACGATACTTAGTGAGTATATGTGACTACGACTTACTGTAGTAAAGAAGATTTTAGTCACATAGATGATTACTATAAGAGAAGGGTTCTTGTCGAAGTATAAACTGCATCAGAACGCGACACTCTCTACTTAACAAGAAAAA
TGTACTAGAACATTTAAGGACCGAAGCTTGTGTGCTTGACAGGTACTATTGAAAATAGGCTGATTCGTGATTTCCAAGACTAGATTAATGGGTCAATGCAGAAAAGGTGTAGAGGGAACTTCGATCATTTCATAATAGGAAACAAGCTGCGCTCGACGGCACCACACGTTGAATTTACCTCATCTCCTGGAGACGTGGTGTGGTTGACAGGATCTATGCACAAGTCGAATACAGGGTGATTGGATCTCAGCTCGAATGGGGTAGAAGTGGGTAAGATTAAACTTCTTCATGATTAATCCTTAGCACCATAAGTGCTCGCTTCCTGCGTACGTGCGGTCGGAGTTTTGAAATATGCTTCAGTGGAATAGTCCGAGATATCTAAAATCCAGGCGTCCCAACATTCATATATGGGTAGCTGCACCATTGGAACACTCCTACTCTGCGATTAAAGAATAAAGGCTGGGTGCTCTACAGCCTCATTCCTCAATAGGTCGGCTGGCTGAGAGGCTCTAAAGTTATAACGCACTAAGGTGATATGGAGTACACCTCCCAAGGTGACCAGCAGTTGACGAGCGTACCTAGGCTTCTATAAAGCATAACACCTATCTAGCTGGCCAGCGAGACAGGGTCATATGAAAAAACGGTGCGTCCTGAAAACGTTATCACCGTGAATAGTATAAAGGCTGCCTCCACTTCAGCACGTATGGTCGATAAGATATTACGTGAATACCATTTGTCGGTTTATCCCTTATTGGTACTCTCCACCCAATGAAAAATGGACCGTTGGTACTCTCGCCAATTGCGACTTAAGTAAATACCATATCTGCTCGGAACCTACATAACATATAACTTGGGATCGTGCGGACGGTCGATGGATCACTGCTGGACTCGTTACAACGAACACTCCCTAGATACATATTTCGTGAACACCGTAGGAACTAATAAGCACCATTCCTCTTCTGGGTGATTGGTTGTGTCGGAAGTTCGATTACTCCACCATTCCACGATTGCGCATGAAGAAATTTGCGTAGGTGGTGGGCTACATTTAAGGTACCAAGGAAATCAGCGATCATAGATATATGGATATCTGGCACGGACCAATTCTGCCGAACAACTGCGTAAGAAAATACTTTATCTCCAGCTTTCCGAAGCACGTCGCGTAGAATTATCGGAGAATCGTCAATTGGTATACTCGAGGGAAGCTGACGTTCATAAATGGGCATGACGACCGCACGGACTCTACATATTTCGATGGTTCGAGGGCTGGCATCTAACAATTTAGGCGTAGAGGACCCGTCGGTCTGAGGGTACTTACTAATAACTATCTTTCTACCGATCTTATAGTACTTATAACCCTAGCAGGAAGACAGCCAATGTGCGTGACAGCATCAGTCGTGGCAACGATTGCTCGAAGTGTTCTATAAAGCAAACCTGGTCGGGTGCTGGAGAGGTGGACTCCTTCTGACCAGGCAAGCGACAATTGATTAAACCACATGAGGGTGAATACATATATGCTGCTCAGCTTAACAGCATGTATGGTTCAGAAGTTAAAACGAGGACAGGAAGTCATCTTTAATGCTGGATTGGTTATCTCGGTCTGACCTTGGGTGCTCATATACTTTATACCTTATCTTCTTAATTCGTGCTTACCAGGGCAGCGAGAAATCATTTAAGGTTTTCTGCTCGCATCGATCTATTCTATTTACAACTAGTTGAAATAAGCAGGATACCAGCCCACGGTGCATCCTACTCTTGAAATTAGGCCTTCTCGTCGGGTGGGTGTGAAGTTTATAGGTTCACAGGGAGCATCGAAGTGTGCACGCAAAGTTTAAAGCACGTGACCTCGGGAGCGTTCATGGATGACTAGTTTATACCCACTAAGCTCATATGCTTATGACGAGGCAATCTATTAAGGGACTTTCGTGTATACGAAAAGACCCTCAATTGTCCGA
Lol I was gonna respond back in the code but was like “nah people are gonna be scrolling for days” but mood and I too cannot wait for TVC. A time is being had waiting fam.
IT’S NOT JUST YOUR TWITTER, IT’S YOUR COMMENTS AND YOUR DMS I’M JUST SAYING. I tried not thinking about what was in store, LOL. And yesssssss we took our sweet time but it was well worth that sweet time because after those chapters (with me complaining a lot – bless you and Sam for dealing with me), we were in for a ride.
Hahaha yea my notifs everywhere were alight, you are correct! Honestly I don’t think my soul can wait until book 3 is published!
I mean, if you want someone to keep your soul again…. 😉
NO! Keep your grim reaper ass away from me and my soul!
I really, really, really, really, REALLY need to read these!!!! They are way far up on my TBR and I am so glad to read a good review!!
(You REALLY REALLY do, Lindsey!)
Yes you do need to read them, please do because they are so good!!!!
Love this review! I’m yet to read this one💚
DO ITTTTTTTTTTTTTTTTTTT.
I absolutely loved This Mortal Coil when I read it as an ARC when a copy showed up on my doorstep. It was exactly what’s been lacking in young adult reads, that intelligence and imagination of technology driven societies beyond the average dystopian novel. Book one being so fast paced, it’s nice that this one slows it down a little, it sounds as though we get to learn more about the characters and world around them which I was really hoping for. I really need to grab a copy and soon. Brilliant review Kaleena, loved it!
This Mortal Coil is one of the best books that I’ve read in a long time, it is honestly everything that I had been hoping for but didn’t know it! How cool that you were able to read the ARC! There’s definitely more information about our characters and the backstory in this one, and I really enjoyed getting deeper into the web. I hope you enjoy it as much as I did
Bahahaha okay you just made my day with the nucleic acid sequence coding!!!!!!!! 🧬💖✨ LOVED IT! 👩🏻🔬
YAY that pleases me greatly, and honestly I think that means you will love this series! This Mortal Coil has “pigeon poems” that are nucleic acid sequenced, and the author’s website has a place to encode / decode messages. It’s so nerdy and awesome.
Well that makes it the easiest add to my TBR this week! 😍 I’ll have to see if my library has a copy I can check out sometime! (Currently postponing physical books rn except for the few arcs I would like to finish prior to pub dates). If you have anymore nerdy recs you know where to find me! 😉😉😉 OH!!! Have you decoded the binary codes in The Illuminae Files? I need to reread those sometimes so I can!!
I hope you can get a copy soon & love it as much as I do!!! I know what you mean though, I am trying to curb my own spending because my owned TBR is out of control… I know no chill. I haven’t, but I should now that you mention it!
Hehe my book-buying diet has taken years of practice! I’m always maxed out on my Libby library holds instead! 😂
I SWEAR all my Libby holds came in at once and now I am panicking because I have so many loans and no time and I just want to read everything.
YES!! Which is why I end up returning unread materials and going back in the queue 😂😂😂
So glad you enjoyed this one! I hope to get to it sometime this year, my backlog is immense lol.
*whispers* Ignore the backlog.
Lol
Soph speaks the truth, Lisa.
I have been ignoring to some extent, just want to get caught up on a few more books and then I’ll be good to go. 😀
I know what you mean, I definitely want to do some personal mood reading but have a couple others I want to finish first for guilt-free reading!
I feel you on the backlog so hard… mine is so bad and all I want to do is play video games & re-read Ace of Shades. So essentially I am doing a-ok and this slump is fine
You’re killing my tbr list. But I love you and your review!
We all love Kal despite her killing the TBR, but I think the TBR kills all of us.
YOUR TBR WILL SUCCUMB TO MY WILL! Honestly though, this series is incredible and I will shove it at everyone I know until they read it. Definitely worth the read!
MY TBR OBEYS NO ONE BUT ME AND IT WILL NEVER SUCCOMB.
Challenge accepted.